iProEP
Site news:
>Seq 1 of H. sapiens or D. melanogasteror or C. elegans
AGCTCGGAAATCCACCGGCGGTAAAGCGCCACGCAAGCAGCTGGCTACCAAGGCTGCTCGCAAGAGCGCGCCGGCTACCGG
AAAGCCTCACCGTTACCGTCCGGGTACTGTGGCTCTGCGTGAGATCCGCCGCTACCAAAAGTCGACCGAGTTGCTGATTCG
GTTCCAGCGCCTGGTGCGAGAAATCGCCCAAGACTTCAAGACCGATCTTCGCTTCCAGAGCTCTGCGGTAATGGCGCTGCA
GAAGCTGCCGGAGGCTTGCGGTGTGAATGAGGCCTACTTGGTAGGGCTCTTTGAGGATAGGAACGGATTT
>Seq 2 of B. subtilis or E. coli
GTTTCCCTTATTTTTTGATAAAAGGCTTCCGAAGAAACGTAACTGTGGTATGATGTATGGAAGATAGCTAGGAACGGATTT
NOTE: (1) For each submission, the number of DNA sequences is limited at 1000;
(2) Each DNA sequence must start with a greater-than symbol (">") in the first column. The words right after the ">" symbol in the single initial line are optional and only used for the purpose of identification and description.
(3) The query DNA sequence of H. sapiens or D. melanogasteror or C. elegans should be no shorter than 300-bp. The query DNA sequence of B. subtilis or E. coli should be no shorter than 81-bp. The accepted characters are: A, C, G, T. If a query sequence contains any illegal character, the prediction will be stopped.