Site news:
- New predictor
>Seq 1
AAUCGUAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGG
>Seq 2
UGGCUUUAAUACUUCUGAAGACACAAUAGCUAAGACCCAAA
NOTE: (1) For each submission, the number of RNA sequences is limited at 100 or less;
(2) Each RNA sequence must start with a greater-than symbol (">") in the first column. The words right after the ">" symbol in the single initial line are optional and only used for the purpose of identification and description.
(3) The query RNA sequence should be no shorter than 41 characters. The accepted characters are: A, C, G, U. If a query sequence contains any illegal character, the prediction will be stopped.