PPD - Promoters
| SpeciesID | 12 |
|---|---|
| PromoterID | 2709 |
| Type | chr |
| Promoter Name | spoVSp |
| Starin Name | Bacillus subtilis subsp. subtilis str. 168 |
| Gene Name | spoVS |
| Gene Start | 1769935 |
| Gene End | 1770195 |
| Gene Product | regulator required for dehydratation of the spore core and assembly of the coat (stage V sporulation) |
| TSS Position | NA |
| Strand | + |
| Locus_tag | BSU_16980 |
| Sequence | aaaagcaggaatatagcaactccttagtgaatatagtaaaaa |