PPD - Promoters
| SpeciesID | 12 |
|---|---|
| PromoterID | 2678 |
| Type | chr |
| Promoter Name | spo0Mp |
| Starin Name | Bacillus subtilis subsp. subtilis str. 168 |
| Gene Name | spo0M |
| Gene Start | 954149 |
| Gene End | 953373 |
| Gene Product | protein involved in the control of the cell cycle as a function of the environment |
| TSS Position | NA |
| Strand | - |
| Locus_tag | BSU_08760 |
| Sequence | aataataggaaaaaagtatgaatcaaacgaatcttttttcct |